DB identifier
![]() |
AT5G60408 | Secondary Identifier
![]() |
locus:4010714062 |
Name
![]() |
microRNA391 |
TAIR Computational Description | microRNA ath-MIR391 precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA of the miR390 family with unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCAGGAGAGAUAGCGCCA |
TAIR Short Description | MIR391; miRNA |
TAIR Aliases | MIR391 |