DB identifier
![]() |
AT5G39693 | Secondary Identifier
![]() |
locus:4515103663 |
Name
![]() |
microRNA869A |
TAIR Computational Description | microRNA ath-MIR869 precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUGGUGUUGAGAUAGUUGAC |
TAIR Short Description | MIR869a; miRNA |
TAIR Aliases | MIR869A |