DB identifier
|
AT4G03455 | Secondary Identifier
|
locus:4010713863 |
| Name
|
microRNA447B |
| TAIR Computational Description | microRNA ath-MIR447b precursor;(source:Araport11) |
| TAIR Curator Summary | Encodes a microRNA that targets several 2-phosphoglycerate kinase-related family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGGGACGAGAUGUUUUGUUG |
| TAIR Short Description | MIR447B; miRNA |
| TAIR Aliases | MIR447B |
Powered by
Have you tried our InterMine mobile apps?
and interoperation is funded by 
