DB identifier
|
AT2G46255 | Secondary Identifier
|
locus:4010713713 |
| Name
|
microRNA159C |
| TAIR Computational Description | microRNA ath-MIR159c precursor;(source:Araport11) |
| TAIR Curator Summary | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCCU |
| TAIR Short Description | MIR159C; miRNA |
| TAIR Aliases | MIR159C |
Powered by
Have you tried our InterMine mobile apps?
and interoperation is funded by 
