DB identifier
![]() |
AT2G46255 | Secondary Identifier
![]() |
locus:4010713713 |
Name
![]() |
microRNA159C |
TAIR Computational Description | microRNA ath-MIR159c precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCCU |
TAIR Short Description | MIR159C; miRNA |
TAIR Aliases | MIR159C |