DB identifier
|
AT5G46845 | Secondary Identifier
|
locus:1009023471 |
| Name
|
microRNA160C |
| TAIR Computational Description | microRNA ath-MIR160c precursor;(source:Araport11) |
| TAIR Curator Summary | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). ARF17 targeted gene is required for megaspore mother cell specification. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA |
| TAIR Short Description | MIR160/MIR160C (MICRORNA160); miRNA |
| TAIR Aliases | MIR160, MIR160C |
Powered by
Have you tried our InterMine mobile apps?
and interoperation is funded by 
