DB identifier
![]() |
AT1G07051 | Secondary Identifier
![]() |
locus:4515102503 |
Name
![]() |
microRNA847A |
TAIR Computational Description | microRNA ath-MIR847 precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCACUCCUCUUCUUCUUGAUG |
TAIR Short Description | MIR847a; miRNA |
TAIR Aliases | MIR847A |