help  | faq  | software  | BAR

Gene : MIR834A A. thaliana

DB identifier  ? AT5G08210 Secondary Identifier  ? locus:2181544
Name  ? microRNA834A
TAIR Computational Description  microRNA ath-MIR834 precursor;(source:Araport11)
TAIR Curator Summary  Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA
TAIR Short Description  MIR834a; miRNA
TAIR Aliases  MIR834A

0 Gene Rifs

1 Organism

Trail: Gene

2 Publications

Trail: Gene

0 Synonyms

Genomics

Sequence Feature Displayer

Gene Structure Displayer

Overlapping Features Displayer

1 Child Features

Trail: Gene

0 Cross References

0 Downstream Intergenic Region

0 Located Features

0 Upstream Intergenic Region

Proteins

Uni Prot Comments Displayer

0 Proteins

Function

Gene Ontology Displayer

Interactions

Cytoscape Network Displayer

Expression

Bar Efp Browser Displayer

Atted Displayer

Homology

Phytomine Ortholog Displayer

0 Homologues

 

Other

4 Data Sets

Trail: Gene