help  | faq  | software  | BAR
Hide

Oops!

https://bar.utoronto.ca/thalemine/service/ is incorrect
Hide Your session has expired. If you were not logged in, your data (including query history and any lists you made) has been cleared.Your session has expired. If you were not logged in, your data (including query history and any lists you made) has been cleared.

Gene : MIR418 A. thaliana

DB identifier  ? AT3G18895 Secondary Identifier  ? locus:4010713759
Name  ? microRNA418
TAIR Computational Description  microRNA ath-MIR418 precursor;(source:Araport11)
TAIR Curator Summary  Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAATGTGATGATGAACTGACC
TAIR Short Description  MIR418; miRNA
TAIR Aliases  MIR418

0 Gene Rifs

1 Organism

0 Publications

0 Synonyms

Genomics

Genome feature

Region: gene ? Length: 73  
Location: Chr3:6516218-6516290

Gene models - MIR418 AT3G18895

? Gene models

Overlapping Features

? Genome features that overlap coordinates of this Gene

1 Child Features

0 Cross References

1 Downstream Intergenic Region

0 Located Features

1 Upstream Intergenic Region

Proteins

Curated comments from UniProt

No comments found

0 Proteins

Function

Gene Ontology

cellular component
No terms in this category.
molecular function
No terms in this category.
biological process
No terms in this category.

Interactions

Interaction Network

Show the following interaction types:
Reset view
Show in table format
Export graph

Click on a gene to get more info about it.

Expression

eFP Visualization

Data Source: BAR




Co-expression

Querying ATTED Service...
Data Source: ATTED-II
Top N
LS: LS is a monotonic transformation (negative logit) of MR index. Larger LS indicates stronger co-expression.

 

Homology

Phytozome Homologs

Data Source: Phytozome


0 Homologues

 

Other

4 Data Sets