https://bar.utoronto.ca/thalemine/service/ is incorrect
Hide
Your session has expired. If you were not logged in, your data (including query history and any lists you made) has been cleared.Your session has expired. If you were not logged in, your data (including query history and any lists you made) has been cleared.
Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAATGTGATGATGAACTGACC