help  | faq  | software  | BAR
Hide

Oops!

https://bar.utoronto.ca/thalemine/service/ is incorrect
Hide Your session has expired. If you were not logged in, your data (including query history and any lists you made) has been cleared.Your session has expired. If you were not logged in, your data (including query history and any lists you made) has been cleared.

Gene : MIR837A A. thaliana

DB identifier  ? AT1G18879 Secondary Identifier  ? locus:4515102548
Name  ? microRNA837A
TAIR Computational Description  microRNA ath-MIR837 precursor;(source:Araport11)
TAIR Curator Summary  Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AUCAGUUUCUUGUUCGUUUCA
TAIR Short Description  MIR837a; miRNA
TAIR Aliases  MIR837A

0 Gene Rifs

1 Organism

0 Publications

0 Synonyms

Genomics

Genome feature

Region: gene ? Length: 184  
Location: Chr1:6520941-6521124

Gene models - MIR837A AT1G18879

? Gene models

Overlapping Features

? Genome features that overlap coordinates of this Gene

1 Child Features

0 Cross References

0 Downstream Intergenic Region

0 Located Features

0 Upstream Intergenic Region

Proteins

Curated comments from UniProt

No comments found

0 Proteins

Function

Gene Ontology

cellular component
No terms in this category.
molecular function
No terms in this category.
biological process
No terms in this category.

Interactions

Interaction Network

Show the following interaction types:
Reset view
Show in table format
Export graph

Click on a gene to get more info about it.

Expression

eFP Visualization

Data Source: BAR




Co-expression

Querying ATTED Service...
Data Source: ATTED-II
Top N

 

Homology

Phytozome Homologs

Data Source: Phytozome


0 Homologues

 

Other

4 Data Sets