help  | faq  | software  | BAR

Search our database by keyword

Examples

  • Search this entire website. Enter identifiers, names or keywords for genes, pathways, authors, ontology terms, etc. (e.g. eve, embryo, zen, allele)
  • Use OR to search for either of two terms (e.g. fly OR drosophila) or quotation marks to search for phrases (e.g. "dna binding").
  • Boolean search syntax is supported: e.g. dros* for partial matches or fly AND NOT embryo to exclude a term

Search results 1 to 1 out of 1 for AT2G34202

0.016s

Categories

Hits by Category

Hits by Organism

Type Details Score
Gene
Length: 100  
Chromosome Location: Chr2: 14442978-14443077
Organism . Short Name: A. thaliana
TAIR Computational Description: microRNA ath-MIR399d precursor;(source:Araport11)
TAIR Curator Summary: Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. Mature sequence: UGCCAAAGGAGAUUUGCCCCG
TAIR Short Description: MIR399D; miRNA
TAIR Aliases: MIR399D