Encodes a novel protein of unknown function that is essential for embryonic development. Severe loss of function alleles are embryo lethal. Analysis of a partial loss of function allele indicates a role for EMB1611 in regulation of endoreduplication and maintenance of meristem cell fate. It appears to be required for maintaining the CLV-WUS regulatory pathway.
Encodes VAD1 (Vascular Associated Death1), a regulator of cell death and defense responses in vascular tissues. VAD1 is a putative membrane associated protein and contains a GRAM domain. vad1 is a lesion mimic mutant that exhibits light conditional appearance of propagative HR (hypersensitive response)-like lesions along the vascular system. The mRNA is cell-to-cell mobile.
Calcium-dependent phospholipid-binding Copine family protein;(source:Araport11)
TAIR Curator Summary:
Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Overexpression of this gene suppresses bon1-1 phenotypes. Double mutant analyses with bon1-1 suggest that BON1 and BON3 have overlapping functions in maintaining cellular homeostasis and inhibiting cell death.
TAIR Short Description:
Calcium-dependent phospholipid-binding Copine family protein
Encodes a member of the Arabidopsis response regulator (ARR) family, most closely related to ARR15. A two-component response regulator protein containing a phosphate accepting domain in the receiver domain but lacking a DNA binding domain in the output domain. Involved in response to cytokinin and meristem stem cell maintenance. Arr7 protein is stabilized by cytokinin.
snRNA activating complex family protein;(source:Araport11)
TAIR Curator Summary:
Encodes a protein similar to human SNAP50. Mutants display different temperature sensitivities in the dedifferentiation of cells from different organs. Mutation inhibits the dedifferentiation-associated accumulation of U-snRNAs and some other small RNA species encoded by independent-type genes carrying the USE and TATA box. Required for the elevation of cell proliferation competence in hypocotyl dedifferentiation.
Non-specific lipid transfer protein. Binds calmodulin in a Ca2+-independent manner. Localized to the cell wall. Specifically expressed in L1 epidermal layer. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. The mRNA is cell-to-cell mobile.
Plant-specific transcription factor YABBY family protein;(source:Araport11)
TAIR Curator Summary:
Encodes a member of the YABBY family of transcriptional regulators that is involved in abaxial cell type specification in leaves and fruits. YAB1 acts in a non-cell autonomous fashion within the meristem to affect phyllotactic patterning. The non-autonomous effect on the central region of the meristem is mediated through the activity if Lateral Suppressor (LAS).
TAIR Short Description:
Plant-specific transcription factor YABBY family protein
transducin family protein / WD-40 repeat family protein;(source:Araport11)
TAIR Curator Summary:
Encodes a transducin family nucleolar protein with six WD40 repeats that is most likely involved in 18S rRNA biogenesis. The slow progression of the gametophytic division cycles in swa1 suggested that the SWA1 protein is required for the normal progression of mitotic division cycles through the regulation of cell metabolism. Ubiquitously expressed throughout the plant.
TAIR Short Description:
transducin family protein / WD-40 repeat family protein
TEOSINTE BRANCHED 1, cycloidea and PCF transcription factor 3;(source:Araport11)
TAIR Curator Summary:
Encodes a member of a recently identified plant transcription factor family that includes Teosinte branched 1, Cycloidea 1, and proliferating cell nuclear antigen (PCNA) factors, PCF1 and 2. Regulated by miR319. Involved in heterochronic regulation of leaf differentiation. Elongates hypocotyl when miR319-resistant version is overexpressed. Suppresses auxin response by activating IAA3/SHY2 and SAUR genes.
TAIR Short Description:
TEOSINTE BRANCHED 1, cycloidea and PCF transcription factor 3
Similar to maize DEK1, a gene encoding a membrane protein of the calpain gene superfamily required for aleurone cell development in the endosperm of maize grains. A key component of the embryonic L1 cell-layer specification pathway. It localizes to membranes and undergoes intramolecular autolytic cleavage events that release the calpain domain into the cytoplasm.
K-box region and MADS-box transcription factor family protein;(source:Araport11)
TAIR Curator Summary:
Encodes a MADS box transcription factor expressed in the carpel and ovules. Plays a maternal role in fertilization and seed development. Controls the structure and mechanical properties of the seed coat. Controls fruit size by regulating cytokinin levels and FRUITFULL.Binds upstream of several cell wall modifying enzymes including PMEI6 and XYL1 and regulates their expression.
TAIR Short Description:
K-box region and MADS-box transcription factor family protein
Glycosyl hydrolase family 35 protein;(source:Araport11)
TAIR Curator Summary:
Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35
Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. ROXY2, together with ROXY1 (AT3G02000), controls anther development. roxy1 roxy2 double mutants are sterile and do not produce pollen. As part of miR319-TCPs-TGA9/TGA10/ROXY2 regulatory module controls cell fate specification in early anther development.
Encodes a protein with similarity to mammalian transcriptional coactivator that is involved in cell proliferation during leaf and flower development. Loss of function mutations have narrow, pointed leaves and narrow floral organs. AN3 interacts with members of the growth regulating factor (GRF) family of transcription factors.Identified as a subunit shared by BRM- and SYD-associated SWI/SNF complexes (PMID:36471048).
Encodes a member of the MADS box family of transcription factors. Involved in root cell differentiation and flowering time. Loss of function mutations have abnormal cellular differentiation in the roots and are late flowering. AGL12 along with AGL14, and AGL17 is preferentially expressed in root tissues and represent the only characterized MADS box genes expressed in roots.
Encodes MCP2d, the predominant and constitutively expressed member of type II metacaspases (MCPs). MCP2d plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death (PCD). Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a�f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. The mRNA is cell-to-cell mobile.
Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality.
Cyclin-dependent kinase inhibitor family protein;(source:Araport11)
TAIR Curator Summary:
Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. Involved in trichome branching.
Dof-type zinc finger DNA-binding family protein;(source:Araport11)
TAIR Curator Summary:
CDF4 is member of the group II DOF transcription factor family is involved in regulation of differentiation root columella cells. It is a direct target of the transcriptional repressor WOX5. CDF4 itself is a transcriptional repressor that appears to repress root columella stem cell identity. Ectopic expression of CDF leads to premature differentiation of root columella cells.
Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity.
TAIR Short Description:
Beige/BEACH domain ;WD domain, G-beta repeat protein
Encodes a metacaspase (cysteine-type endopeptidase) that is involved in promoting programmed cell death in response to hydrogen peroxide (H2O2), UV light, and methyl viologen (MV). Transcript levels rise in response to UV-C, H2O2, and MV. In vitro assays demonstrate that this enzyme has a preference for cleaving after an arginine residue, and it has a pH optimum of 8.0.
A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Regulates interspecies reproductive barriers through the regulation of cell wall modification genes.
Encodes GSL8, a member of the Glucan Synthase-Like (GSL) family believed to be involved in the synthesis of the cell wall component callose. GSL8 is required for male gametophyte development and plant growth. Has a role in entry of microspores into mitosis. Also refer to GSL10 (At3g07160). Required for the function and plasmodesmal localization of PDLP5.
TAIR Short Description:
glucan synthase-like 8
TAIR Aliases:
ATGSL08, ATGSL8, CALS10, CHOR, ET2, GSL08, GSL8, MAS
Encodes a protein with phosphatidylinositol-4-phosphate 5-kinase activity that plays a role in pollen tip growth. The enzyme localizes to the apical plasma membrane and adjacent cytosolic region of pollen tubes. Overexpression of this gene leads to increased deposition of pectin in the cell wall at the tip of the pollen tube and causes altered pollen tube morphology.
Far-red impaired responsive (FAR1) family protein;(source:Araport11)
TAIR Curator Summary:
Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins.
RGP1 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1/rgp2 (at5g15650) double mutants have a male gametophyte lethal phenotype. RGP1 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. The mRNA is cell-to-cell mobile.
Far-red impaired responsive (FAR1) family protein;(source:Araport11)
TAIR Curator Summary:
Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins.
WOX5 is a member of the Wuschel (WUS) family of homeodomain transcription factors and is required for quiescent center (QC) function and columella stem cell maintenance in the root meristem. It is expressed in the QC and moves to the columella stem cells where it represses their differentiation. WOX5 binds members of the Topless family of transcriptional co-repressors.
Encodes a protein similar to yeast HAL3, which regulates the cell cycle and tolerance to salt stress through inhibition of the PPZ1 type-1 protein phosphatase. AtHAL3b mRNA levels are induced by salt stress. HAL3B presumably encodes for phosphopantothenoylcysteine decarboxylase being involved in Coenzyme A biosynthesis as indicated by functional complementation of a double mutant hal3 aaBb.
Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11)
TAIR Curator Summary:
Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region.
TAIR Short Description:
Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein
Encodes a epidermally expressed extracellular protein that likely functions as an alpha-beta hydrolase and is required for normal cuticle formation. Homozygous mutant plants are dwarfed and have abnormal leaves, collapsed cells, reduced numbers of trichomes. The specific role of BDG is unclear: it may function in cutin biosynthesis or as a cross-linking enzyme in the cell wall itself.
Encodes a protein with phosphatidylinositol-4-phosphate 5-kinase activity that plays a role in pollen tip growth. The enzyme localizes to the apical plasma membrane and adjacent cytosolic region of pollen tubes. Overexpression of this gene leads to increased deposition of pectin in the cell wall at the tip of the pollen tube and causes altered pollen tube morphology.
Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11)
TAIR Curator Summary:
Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region.
TAIR Short Description:
Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein
Encodes the alpha-subunit shared between protein farnesyltransferase and protein geranylgeranyltransferase-I. Involved in protein prenylation: covalent attachment of the C-15 isoprene farnesyl or the C-20 isoprene geranylgeranyl groups to the C-terminal end of some proteins. Involved in shoot and flower meristem homeostasis, and response to ABA and drought. Also regulates leaf cell shape. Mutant is epistatic to era1.
Far-red impaired responsive (FAR1) family protein;(source:Araport11)
TAIR Curator Summary:
Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins.
Trihelix transcription factor induced by osmotic and salt stress. Binds to a conserved AGAG-box sequence in the promoter of genes it regulates. Regulates the expression of stress tolerance genes, resulting in reduced reactive oxygen species, Na+ accumulation, stomatal apertures, lipid peroxidation, cell death and water loss rate, and increased proline content and reactive oxygen species scavenging capability.
Encodes ribosomal protein L5 that binds to 5S ribosomal RNA and in involved in its export from the nucleus to the cytoplasm. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2.
Encodes a cysteine-rich peptide that is expressed in the synergid cell and appears to be secreted toward the funicular surface through the micropyle. Its closely related family members are involved in pollen tube guidance but this particular peptide lacks a conserved cysteine residue that appears critical for this function and does not affect pollen tube guidance.
Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). ARF17 targeted gene is required for megaspore mother cell specification. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA
membrane steroid binding protein 1;(source:Araport11)
TAIR Curator Summary:
Encodes a protein with similarity to progesterone-binding proteins in animals. Has been shown to bind steroids in vitro. Expressed in aerial portions of the plant excluding mature flowers and siliques. Antisense experiments suggest a role in inhibition of hypocotyl cell elongation. Expression is suppressed light grown seedlings transferred to the dark. The mRNA is cell-to-cell mobile.
Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division.
Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed throughout both the main and the lateral root, with intensive expression at the dividing and elongating regions. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems.
Encodes glutamine 5-phosphoribosylpyrophosphate amidotransferase. Mutants are deficient in leaf, but not cotyledon, plastid and palisade cell development. Mutants exhibit defective chloroplast development under non-low light, suggesting that the defect in chloroplast development is caused by photo-oxidative damage. Plays role in differential development of vascular-associated cells. Demonstrates a cell-specific difference in chloroplast development.Mutant leaves are highly reticulate with a green vascular pattern.
Encodes a member of the plant specific ovate protein family. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. This interaction may mediate relocalization of the TALE homeodomain from the nucleus to the cytoplasm. Functions as a transcriptional repressor that suppresses cell elongation. May also directly affect microtubule organization via interactions with TON2.
zinc finger (Ran-binding) family protein;(source:Araport11)
TAIR Curator Summary:
Encodes a zinc-finger motif containing protein that is essential for chloroplast RNA editing. The protein physically interacts with ORRM1 and other components of chloroplast editosomes. VAR3 is a part of a protein complex required for normal chloroplast and palisade cell development. Mutants display a variegated phenotype due to somatic areas lacking or containing developmentally retarded chloroplasts and greatly reduced numbers of palisade cells.
encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family (TINY). The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic or overexpression of this gene in a Ds tagged line has reduced cell expansion. The expression of this gene is induced by ethylene and light and appears to stimulate cytokinin biosynthesis.
Transmembrane amino acid transporter family protein;(source:Araport11)
TAIR Curator Summary:
Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile.
TAIR Short Description:
Transmembrane amino acid transporter family protein
Negative regulator of GA responses, member of GRAS family of transcription factors. Also belongs to the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. RGL1 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Involved in flower and fruit development.
NERD1 is a single copy locus encoding a protein of unknown function that is localized to the nucleus. Single mutants show defects in root hair growth, root meristem function, cell elongation. NERD1 appears to act synergistically with the exocyst in root development.Expression of primexine synthesis and callose wall deposition-related genes is reduced in mutants and exine formation is affected rendering plants male sterile.
TP8 is a tonoplast localized member of CDF family of cation transporters. It functions in roots as an Mn transporter.MTP8 transports manganese into root vacuoles of iron-deficient plants and thereby prevents inhibition of iron deficiency-induced ferric chelate reductase by manganese. In seed embryos, MTP8 is responsible for manganese and iron enrichment in the subepidermal cell layer (particularly in vit1 mutant background.)
Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
TAIR Curator Summary:
Encodes a legume-type lectin receptor kinase that is structurally distinct from the mammalian extracellular ATP receptors and acts as an extracellular ATP receptor in Arabidopsis. Extracellular ATP acts as a damage-associated molecular pattern in plants, and its signaling through P2K1 is important for mounting an effective defense response against various pathogenic microorganisms. It also plays a role in cell wall-plasma membrane adhesion.
TAIR Short Description:
Concanavalin A-like lectin protein kinase family protein
breaking of asymmetry in the stomatal lineage;(source:Araport11)
TAIR Curator Summary:
Encodes BASL (BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE), a regulator of asymmetric divisions. In asymmetrically dividing stomatal-lineage cells, BASL accumulates in a polarized crescent at the cell periphery before division, and then localizes differentially to the nucleus and a peripheral crescent in self-renewing cells and their sisters after division. Its transcript levels change after inducing MUTE expression in a mute background.
ethylene-responsive element binding protein;(source:Araport11)
TAIR Curator Summary:
Encodes a member of the ERF (ethylene response factor) subfamily B-2 of the plant specific ERF/AP2 transcription factor family (RAP2.3). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.It is localized to the nucleus and acts as a transcriptional activator through the GCC-box. It has been identified as a suppressor of Bax-induced cell death by functional screening in yeast and can also suppress Bax-induced cell death in tobacco plants. Overexpression of this gene in tobacco BY-2 cells confers resistance to H2O2 and heat stresses. Overexpression in Arabidopsis causes upregulation of PDF1.2 and GST6. It is part of the ethylene signaling pathway and is predicted to act downstream of EIN2 and CTR1, but not under EIN3. The mRNA is cell-to-cell mobile.
Contains the same novel zinc finger motif with LSD1, a negative regulator of cell death and defense response. Due to differential splicing, it encodes two different proteins, one of which contains an additional, putative DNA binding motif. Northern analysis demonstrated that LOL2 transcripts containing the additional DNA binding motif are predominantly upregulated after treatment with both virulent and avirulent Pseudomonas syringae pv maculicola strains.
polygalacturonase inhibiting protein 1;(source:Araport11)
TAIR Curator Summary:
Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium.
Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Intronic sequences are required for its expression in flowers.Acts redundantly with PLT5 and 7 in lateral root pattern formation.
double-stranded DNA binding protein;(source:Araport11)
TAIR Curator Summary:
This gene is predicted to encode a protein that forms part of the topoisomerase VI complex. BIN4 is a nuclear-localized protein that can bind DNA. bin4 mutants are brassinolide-insensitive dwarves with severely reduced cell size in leaves, roots, and hypocotyls. Proper development of root hairs and trichomes is also disrupted in bin4 mutants and they have elevated levels of double strand breaks in their cotyledon cells.
Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens.
Encodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants.
Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. This gene functions in the regeneration of shoots in tissue culture, probably through transcriptional regulation of CUC1. May also be involved in activation of the cell cycle via CycD1;1.
chromatin-remodeling protein 11;(source:Araport11)
TAIR Curator Summary:
Encodes a SWI2/SNF2 chromatin remodeling protein belonging to the ISWI family. Involved in nuclear proliferation during megagametogenesis and cell expansion in the sporophyte. Constitutively expressed. RNAi induced loss of function in megagametogenesis results in female sterility.35S:RNAi plants have reduced stature. Double mutation in CHR17 and CHR11 results in the loss of the evenly spaced nucleosome pattern in gene bodies, but does not affect nucleosome density.
A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate.
AP2/B3-like transcriptional factor family protein;(source:Araport11)
TAIR Curator Summary:
SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. Required for axillary meristem formation and acts by repression of CUC2/CUC3.Based on expression patterns, it is not required for stem cell specification during embryo shoot apical meristem initiation.
Mutants of this gene were initially identified because of the trichome morphogenesis phenotype. Those trichomes have multiple nuclei, a defect that turns out not to be restricted to the trichomes but also in all endoreduplicating cell types. This gene encodes a ubiquitin-binding protein with sequence similarities with yeast proteins that are components of the ESCRTI-III complexes. The Arabidopsis protein is found associated with the endosome.
Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome.
FKBP-type peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
TAIR Curator Summary:
Immunophilin-like protein similar to the p59 FK506-binding protein (FKBP52). Shows rotamase activity and contains an FKBP-like domain and three tetratricopeptide repeat units. Members of this class of mutation show ectopic cell proliferation in cotyledons. Gene may be alternatively spliced. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
TAIR Short Description:
FKBP-type peptidyl-prolyl cis-trans isomerase family protein
Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues.
Encodes an E3 ubiquitin ligase that is involved in plant cell wall modification, seed mucilage extrusion, and controls the degree of pectin methylesterification in seed mucilage. fly1 mutant seeds release more compact mucilage capsules and detached outer tangential primary walls when hydrated in water. Fly1 is located in the endomembrane system, likely localized in late endosome/multivesicular bodies/prevacular compartment. It has been shown to ubiquitinate proteins in conjunction with UBA1 and UBC8.
Member of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis, and development of reproductive structures. EPFLs function as receptor ligands for ERECTA family receptors in adjacent tissues and often triggers downstream activation of BR signaling pathways in different tissues.For example, the EPFL-ER-BZR1-NSN1 cascade that restricts megaspore mother cell differentiation.
COG8 is a component of a putative conserved oligomeric Golgi (COG) complex that is thought to be involved in tethering of retrograde intra Golgi vesicles. It is required for proper deposition of cell wall materials in pollen tube growth. In mutant pollen,golgi appear abnormal.When homozygotes can be produced (by complementing the defect in pollen), the plants are embryo lethal suggesting an essential function. COG8 interacts with several other putative COG components.
A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1�ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Mutants have no ncm5U (5-carbamoylmethyluridine).
RGP2 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1(at3g02230)/rgp2 double mutants have a male gametophyte lethal phenotype. RGP2 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. RGP2 was originally identified as Reversibly Glycosylated Polypeptide-2. Constitutive expression in tobacco impairs plant development and virus spread.
Plant-specific transcription factor YABBY family protein;(source:Araport11)
TAIR Curator Summary:
Putative transcription factor with zinc finger and helix-loop-helix domains, the later similar to HMG boxes. Involved in specifying abaxial cell fate in the carpel. Four putative LFY binding sites (CCANTG) and two potential binding sites for MADS box proteins known as CArG boxes (CC(A/T)6GG) were found in the region spanning 3.8 Kb upstream of the CRC coding region. CRC targets YABBY genes such as YUC4 in gynoecium development.
TAIR Short Description:
Plant-specific transcription factor YABBY family protein
Encodes a putative transcription factor (MYB88), involved in stomata development, double loss of MYB88 and FLP (MYB124) activity results in a failure of guard mother cells (GMCs) to adopt the guard cell fate, thus they continue to divide resulting in abnormal stomata consisting of clusters of numerous guard cell-like cells. This phenotype is enhanced in double mutants over the single mutant flp phenotype. Also regulates female reproductive development.
Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings.
FER-like regulator of iron uptake;(source:Araport11)
TAIR Curator Summary:
Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled.
Encodes the kinesin-like protein PAK has an Armadillo motif tail and is involved in guard cell development in Arabidopsis (from Genbank record AF159052).However, no defect in stomatal complexes has been observed in loss of function mutations. It accumulates at the preprophase band (PPB) in a cell-cycle and microtubule-dependent manner and is most highly expressed in cells where the placement of the division plane (early embryogenesis, stomatal lineages) is critical.
FMO1 is required for full expression of TIR-NB-LRR conditioned resistance to avirulent pathogens and for basal resistance to invasive virulent pathogens. Functions in an EDS1-regulated but SA-independent mechanism that promotes resistance and cell death at pathogen infection sites. FMO1 functions as a pipecolate N-hydroxylase and catalyzes the biochemical conversion of pipecolic acid to N-hydroxypipecolic acid (NHP). NHP systemically accumulates in the plant foliage and induces systemic acquired resistance to pathogen infection.
AtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes.
Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers. The mRNA is cell-to-cell mobile.
TEOSINTE BRANCHED, cycloidea and PCF (TCP) 14;(source:Araport11)
TAIR Curator Summary:
Encodes a transcription factor AtTCP14 that regulates seed germination. AtTCP14 shows elevated expression level just prior to germination. AtTCP14 is predominantly expressed in the vascular tissue of the embryo, and affects gene expression in radicles in a non-cell-autonomous manner. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. Promotes together with TCP8, 7 and 15 endoreduplication-dependent cell expansion in leaf.
Plant-specific transcription factor YABBY family protein;(source:Araport11)
TAIR Curator Summary:
YABBY gene family member, likely has transcription factor activity, involved in specifying abaxial cell fate. Along with FIL, involved in patterning of the fruit. GUS reporter gene expression in seedlings is observed in the young leaves and as the leaf matures, expression is restricted to the abaxial tissues of leaves, expression is also observed on either side of the leaf margin in the younger tissues of leaf blades.
TAIR Short Description:
Plant-specific transcription factor YABBY family protein
Encodes a polycomb group protein. Forms part of a large protein complex that can include VRN2 (VERNALIZATION 2), VIN3 (VERNALIZATION INSENSITIVE 3) and polycomb group proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE) and CURLY LEAF (CLF). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. Performs a partially redundant role to MEA in controlling seed initiation by helping to suppress central cell nucleusendosperm proliferation within the FG.
Member of WRKY Transcription Factor; Group II-c. Involved in the activation of salicylic acid biosynthesis genes ICS1 and PBS3. In the ovule, it is expressed in hypodermal somatic cells and appears to play a role in supression of megasporocyte cell fate. In the leaf if is upstream of FHY3 and regulates light-mediated leaf senescence. Together with WRKY6 and WRKY41 plays a role redundant to WRKY51 in the suppression of RPW8.1
DNA-binding protein with MIZ/SP-RING zinc finger, PHD-finger and SAP domain-containing protein;(source:Araport11)
TAIR Curator Summary:
Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. Regulates leaf cell division and expansion through salicylic acid accumulation. signaling
TAIR Short Description:
DNA-binding protein with MIZ/SP-RING zinc finger, PHD-finger and SAP domain
TOR is a protein kinase, conserved across eukaryotes (called mTOR in mammals), that monitors nutrient availability to coordinate metabolism (PMID: 32649861). TOR is a member of the phosphatidylinositol 3-kinase-related kinases (PIKKs) and forms a stable complex (TOR complex 1, or TORC1) with RAPTOR (At3g08850, At5g01770, PMID: 16377759) and LST8 (At3g18140, At2g22040, PMID: 22307851). TOR is expressed throughout Arabidopsis development (PMID: 32188942, PMID: 32051250) and is required to complete embryogenesis (PMID: 11983923). Diverse nutrients, hormones, and environmental cues can activate or suppress TOR activity (depending on the physiological and developmental context), including sugars (PMID: 23542588), amino acids (PMID: 33831352, PMID: 35327579), nucleotides (PMID: 33793860), auxins (PMID: 28246118), and light (PMID: 28223530). When conditions are favorable, TOR promotes growth by activating cell division (PMID: 23542588), cell expansion (PMID: 33288701), ribosome biogenesis (PMID: 33054972), protein synthesis (PMID: 33054972), and nucleotide synthesis (PMID: 33793860), among other processes. [Curated by Jake Brunkard ORCiD:0000-0001-6407-9393]
Leucine-rich receptor-like protein kinase family protein;(source:Araport11)
TAIR Curator Summary:
Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM1,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM2 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile.
TAIR Short Description:
Leucine-rich receptor-like protein kinase family protein
Leucine-rich receptor-like protein kinase family protein;(source:Araport11)
TAIR Curator Summary:
Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile.
TAIR Short Description:
Leucine-rich receptor-like protein kinase family protein
COG3 is a component of a putative conserved oligomeric Golgi (COG) complex that is thought to be involved in tethering of retrograde intra Golgi vesicles. In mutant pollen,golgi appear abnormal. It is required for proper deposition of cell wall materials in pollen tube growth. When homozygotes can be produced (by complementing the defect in pollen), the plants are embryo lethal suggesting an essential function. COG3 interacts with several other putative COG components.
Encodes a putative MYB transcription factor involved in stomata development, loss of FLP activity results in a failure of guard mother cells (GMCs) to adopt the guard cell fate, thus they continue to divide resulting in abnormal stomata consisting of clusters of numerous guard cell-like cells. This phenotype is enhanced in double mutants with MYB88. Its transcript levels change after inducing MUTE expression in a mute background. Also regulates female reproductive development.
Encodes a GHMP kinase family protein that acts as a galacturonic acid-1-phosphate kinase that catalyzes the production of galacturonic acid-1-phosphate. This is a precursor of the important cell wall building block UDP-galacturonic acid. Based on gene trap line GT8007, the gene appears to be expressed in a petal and stamen-specific manner, between flower stages 8 to 11, however, later RT-qPCR analysis demonstrates that the transcript is present throughout the plant in all tissues tested.
Protein kinase superfamily protein;(source:Araport11)
TAIR Curator Summary:
Encodes BIN2, a member of the ATSK (shaggy-like kinase) family. BIN2 functions in the cross-talk between auxin and brassinosteroid signaling pathways. BIN2 regulates root epidermal cell fate specification by phosphorylating EGL3 and TTG1. BIN2-mediated phosphorylation appears to promote BZR1 export from the nucleus. KIB1 interacts with BIN2 blocking its interaction with substrates and promotes BIN2 degradation. Additionally, BIN2 phosphorylates RAPTOR1B and by doing so, releases the RAPTOR1B's repression of the autophagy pathway.
IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation.
TAIR Short Description:
Nucleotide-diphospho-sugar transferases superfamily protein
Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development.
ROP-interactive CRIB motif-containing protein 4;(source:Araport11)
TAIR Curator Summary:
encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). It interacts with Rop1 and is involved in pollen tube growth and function, and exocytosis in the pollen tube tip. Protein most similar to RIC2 (family subgroup V). Gene is expressed in all tissues examined.Interacts with ROP2 during pavement cell morphogenesis and with ROP1 to promote apical F-actin assembly.
Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP2. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. Plant mutated in both NRP1 and NRP2 genes show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. NRP genes act synergistically with NAP1 genes in promoting somatic homologous recombination.
Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP1. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. Plant mutated in both NRP1 and NRP2 genes show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. NRP genes act synergistically with NAP1 genes in promoting somatic homologous recombination.
Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. Mutations cause defects in both the actin and microtubule cytoskeletons that result in aberrant epidermal cell expansion. itb1 mutants showed irregularities in trichome branch positioning and expansion. The SHD domain of this protein binds to BRK1 and overexpression of the SHD domain results in a dominant negative phenotype. The mRNA is cell-to-cell mobile.
Regulatory-associated protein of TOR 1;(source:Araport11)
TAIR Curator Summary:
Encodes one of two Arabidopsis RAPTOR/KOG1 homologs. RAPTOR proteins are binding partners of the target of rapamycin kinase that is present in all eukaryotes and play a central role in the stimulation of cell growth and metabolism in response to nutrients. Mutants show embryo lethal phenotype which occurs at pre-globular stage. May interact with TOR kinase in a rapamycin like signaling pathway. Interacts with TOR and S6K1 in vivo. Overexpression of RAPTOR1 rendered the S6K1 osmotic stress insensitive.
TAIR Short Description:
HEAT repeat ;WD domain, G-beta repeat protein protein