help  | faq  | software  | BAR

Search our database by keyword

Examples

  • Search this entire website. Enter identifiers, names or keywords for genes, pathways, authors, ontology terms, etc. (e.g. eve, embryo, zen, allele)
  • Use OR to search for either of two terms (e.g. fly OR drosophila) or quotation marks to search for phrases (e.g. "dna binding").
  • Boolean search syntax is supported: e.g. dros* for partial matches or fly AND NOT embryo to exclude a term

Search results 1 to 1 out of 1 for AT2G46255

0.017s

Categories

Hits by Category

Hits by Organism

Type Details Score
Gene
Length: 225  
Chromosome Location: Chr2: 18994632-18994856
Organism . Short Name: A. thaliana
TAIR Computational Description: microRNA ath-MIR159c precursor;(source:Araport11)
TAIR Curator Summary: Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCCU
TAIR Short Description: MIR159C; miRNA
TAIR Aliases: MIR159C