DB identifier | AT5G23065 | Secondary Identifier | locus:1009023497 |
Name | microRNA162B |
TAIR Computational Description | microRNA ath-MIR162b precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA that targets DCL1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGAUAAACCUCUGCAUCCAG |
TAIR Short Description | MIR162B; miRNA |
TAIR Aliases | MIR162B |