DB identifier | AT1G61732 | Secondary Identifier | locus:4515102701 |
Name | microRNA776A |
TAIR Computational Description | microRNA ath-MIR776 precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUAAGUCUUCUAUUGAUGUU |
TAIR Short Description | MIR776a; miRNA |
TAIR Aliases | MIR776A |