DB identifier
|
AT5G58465 | Secondary Identifier
|
locus:4010714058 |
| Name
|
microRNA390B |
| TAIR Computational Description | microRNA ath-MIR390b precursor;(source:Araport11) |
| TAIR Curator Summary | Encodes a microRNA that targets the TAS3 family of tasiRNA-generating transcripts. Cleavage of TAS3 transcripts by miR390 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AAGCUCAGGAGGGAUAGCGCC |
| TAIR Short Description | MIR390B; miRNA |
| TAIR Aliases | MIR390, MIR390B |
Powered by
Have you tried our InterMine mobile apps?
and interoperation is funded by 
