DB identifier | AT5G43603 | Secondary Identifier | locus:1009023398 |
Name | microRNA166F |
TAIR Computational Description | microRNA ath-MIR166f precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
TAIR Short Description | MIR166/MIR166F; miRNA |
TAIR Aliases | MIR166, MIR166F |