DB identifier | AT4G05105 | Secondary Identifier | locus:4010713869 |
Name | microRNA397A |
TAIR Computational Description | microRNA ath-MIR397a precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
TAIR Short Description | MIR397A; miRNA |
TAIR Aliases | MIR397A |