DB identifier | AT4G21362 | Secondary Identifier | locus:4515103430 |
Name | microRNA867A |
TAIR Computational Description | microRNA ath-MIR867 precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAACAUGGUUUAUUAGGAA |
TAIR Short Description | MIR867a; miRNA |
TAIR Aliases | MIR867A |