DB identifier
|
AT5G01747 | Secondary Identifier
|
locus:1009023484 |
| Name
|
microRNA164B |
| TAIR Computational Description | microRNA ath-MIR164b precursor;(source:Araport11) |
| TAIR Curator Summary | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA |
| TAIR Short Description | MIR164/MIR164B; miRNA |
| TAIR Aliases | MIR164, MIR164B |
Powered by
Have you tried our InterMine mobile apps?
and interoperation is funded by 
