DB identifier
|
AT4G30972 | Secondary Identifier
|
locus:1009023331 |
| Name
|
microRNA156B |
| TAIR Computational Description | microRNA ath-MIR156b precursor;(source:Araport11) |
| TAIR Curator Summary | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC |
| TAIR Short Description | MIR156B; miRNA |
| TAIR Aliases | MIR156B |
Powered by
Have you tried our InterMine mobile apps?
and interoperation is funded by 
