DB identifier
|
AT4G23375 | Secondary Identifier
|
locus:4515103440 |
| Name
|
microRNA845B |
| TAIR Computational Description | microRNA ath-MIR845b precursor;(source:Araport11) |
| TAIR Curator Summary | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUCUGAUACCAAAUUGAUG |
| TAIR Short Description | MIR845b; miRNA |
| TAIR Aliases | MIR845B |
Powered by
Have you tried our InterMine mobile apps?
and interoperation is funded by 
