DB identifier
|
AT3G23125 | Secondary Identifier
|
locus:1009023286 |
| Name
|
microRNA173 |
| TAIR Computational Description | microRNA ath-MIR173 precursor;(source:Araport11) |
| TAIR Curator Summary | Encodes a microRNA that targets the TAS1 and TAS2 families of tasiRNA-generating transcripts. Cleavage of TAS1 and TAS2 transcripts by miR173 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCUUGCAGAGAGAAAUCAC |
| TAIR Short Description | MIR173; miRNA |
| TAIR Aliases | MIR173 |
Powered by
Have you tried our InterMine mobile apps?
and interoperation is funded by 
