DB identifier
|
AT1G66725 | Secondary Identifier
|
locus:1009023135 |
| Name
|
microRNA163 |
| TAIR Computational Description | microRNA ath-MIR163 precursor;(source:Araport11) |
| TAIR Curator Summary | Encodes a microRNA that targets several SAMT family members. miR163, is highly expressed in A. thaliana diploids but down-regulated in A. thaliana autotetraploids and repressed in A. arenosa and A. suecica. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGAAGAGGACUUGGAACUUCGAU |
| TAIR Short Description | MIR163; miRNA |
| TAIR Aliases | MIR163 |
Powered by
Have you tried our InterMine mobile apps?
and interoperation is funded by 
