DB identifier | AT1G32582 | Secondary Identifier | locus:4010713496 |
Name | microRNA400 |
TAIR Computational Description | microRNA ath-MIR400 precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA of unknown function that is predicted to target PPR family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAUGAGAGUAUUAUAAGUCAC |
TAIR Short Description | MIR400; miRNA |
TAIR Aliases | MIR400 |