DB identifier
|
AT4G24415 | Secondary Identifier
|
locus:4010713906 |
| Name
|
microRNA824A |
| TAIR Computational Description | microRNA ath-MIR824 precursor;(source:Araport11) |
| TAIR Curator Summary | Encodes a microRNA that targets AGL16. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGACCAUUUGUGAGAAGGGA |
| TAIR Short Description | MIR824a; miRNA |
| TAIR Aliases | MIR824A |
Powered by
Have you tried our InterMine mobile apps?
and interoperation is funded by 
