DB identifier | AT3G59884 | Secondary Identifier | locus:4515103282 |
Name | microRNA827A |
TAIR Computational Description | microRNA ath-MIR827 precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA that targets several SPX C3HC4 RING zinc finger family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUAGAUGACCAUCAACAAACU |
TAIR Short Description | MIR827a; miRNA |
TAIR Aliases | MIR827A |