DB identifier
|
AT2G34202 | Secondary Identifier
|
locus:4010713675 |
| Name
|
microRNA399D |
| TAIR Computational Description | microRNA ath-MIR399d precursor;(source:Araport11) |
| TAIR Curator Summary | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. Mature sequence: UGCCAAAGGAGAUUUGCCCCG |
| TAIR Short Description | MIR399D; miRNA |
| TAIR Aliases | MIR399D |
Powered by
Have you tried our InterMine mobile apps?
and interoperation is funded by 
