DB identifier | AT2G22668 | Secondary Identifier | locus:4010713649 |
Name | microRNA405A |
TAIR Computational Description | microRNA ath-MIR405a precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATGAGTTGGGTCTAACCCATAACT |
TAIR Short Description | MIR405A; miRNA |
TAIR Aliases | MIR405A |