DB identifier | AT1G63005 | Secondary Identifier | locus:4010713580 |
Name | microRNA399B |
TAIR Computational Description | microRNA ath-MIR399b precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CCUGCCAAAGGAGAGUUGCCC |
TAIR Short Description | MIR399B; miRNA |
TAIR Aliases | MIR399B |