help  | faq  | software  | BAR

Gene : MIR399B A. thaliana

DB identifier  ? AT1G63005 Secondary Identifier  ? locus:4010713580
Name  ? microRNA399B
TAIR Computational Description  microRNA ath-MIR399b precursor;(source:Araport11)
TAIR Curator Summary  Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CCUGCCAAAGGAGAGUUGCCC
TAIR Short Description  MIR399B; miRNA
TAIR Aliases  MIR399B

1 Gene Rifs

1 Organism

9 Publications

0 Synonyms

Genomics

Sequence Feature Displayer

Gene Structure Displayer

Overlapping Features Displayer

1 Child Features

0 Cross References

1 Downstream Intergenic Region

0 Located Features

1 Upstream Intergenic Region

Proteins

Uni Prot Comments Displayer

0 Proteins

Function

Gene Ontology Displayer

Interactions

Cytoscape Network Displayer

Expression

Bar Efp Browser Displayer

Atted Displayer

Homology

Phytomine Ortholog Displayer

0 Homologues

 

Other

6 Data Sets