DB identifier | AT1G35501 | Secondary Identifier | locus:4515102635 |
Name | microRNA773A |
TAIR Computational Description | microRNA ath-MIR773a precursor;(source:Araport11) |
TAIR Curator Summary | Encodes a microRNA that targets MET2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUGCUUCCAGCUUUUGUCUC |
TAIR Short Description | MIR773a; miRNA |
TAIR Aliases | MIR773, MIR773A |