help | faq | software | BAR

Gene : MIR171B A. thaliana

DB identifier	AT1G11735	Secondary Identifier	locus:4010713434
Name	microRNA171B

TAIR Computational Description	microRNA ath-MIR171b precursor;(source:Araport11)
TAIR Curator Summary	Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGCCGUGCCAAUAUCACG Expression of this miRNA oscillates during the diurnal cycle. Pri-mRNA coordinates for MIR171b (converted to TAIR10 based on PMID19304749): Chr1: 3961705-3960931 (reverse), length: 775 bp; exon coordinates: exon 1: 3961705 to 3961324, exon 2: 3961237 to 3960931; mature miRNA and miRNA* are located on exon 1.
TAIR Short Description	MIR171B; miRNA
TAIR Aliases	MIR171B

3 Gene Rifs

1 Organism

5 Publications

0 Synonyms

Genomics

Sequence Feature Displayer

Gene Structure Displayer

Overlapping Features Displayer

1 Child Features

0 Cross References

1 Downstream Intergenic Region

0 Located Features

1 Upstream Intergenic Region

Proteins

Uni Prot Comments Displayer

0 Proteins

Function

Gene Ontology Displayer

Interactions

Cytoscape Network Displayer

Expression

Bar Efp Browser Displayer

Atted Displayer

Homology

Phytomine Ortholog Displayer

0 Homologues

Other

6 Data Sets

Questions? Comments? Click here!